THE MOLECULE WHICH STARTS LIFE AT WATERS: THE URACIL BASE
Prof. Dr. Med. Vet. Aydın Evren

Introduction:
Based on the studies of Erwin Schroedinger, we now know that about 5000 nucleotides are lost from the DNA of each human cell by spontaneous hydrolysis due to thermal fluctuations (Schroedinger: 1945 and Alberts: 1983). Furthermore, it is known that some of the deamination products of the DNA bases, such as uracil, hypoxanthine and xanthine are released into the intracellular water. This study focuses on these three DNA deamination products and their behaviour when and if they are not fully metabolised in the organism. My findings lead to interesting conclusions, i.e. the uracil base might have played a crucial role in the evolution process, especially in the conversion of abiogenesis into biogenesis.

Methodology:
I began my research with an examination of two degraded oligonucleotid samples obtained from Gebze Marmara Research Center.
sample 1: 5’ CGGCGGTCTCTCCCAGGGCAGG 3’
sample 2: 5’ AGACTGGATGACTGCCATGG 3’
Then I examined the behaviour of the three DNA deamination products (uracil, hypoxanthine and xanthine, all of which were ordered from SIGMA Chemical Company) under certain conditions.
Initially, I cultured each of these bases in water separately. Than, for each deamination product, I repeated this process several times by changing the quality and quantity of the water. I also conducted various experiments by separately adding sugar, CGH (Chorionic gonadotrophic hormone) and tobacco extract to these cultures. In order to visually observe these DNA deamination products in plants, I took samples from pot grown lily stems and cultured them in water with CGH.
All my experiments and examinations were carried out under sterile conditions. These cultures were prepared by using open, semi-open, closed, mono linear and suspension techniques. None of the cultures were dyed. All preparations were examined and photographed under Nikon Alphaphot2 microscope without using immersion oil. The use of all these methods and techniques enabled me to capture the pleomorphic appearance of lyotropic liquid crystals.
Finally, all preparations and their photographs were compared to a large number of histopathology preparations of arteriosclerosis, multiple sclerosis, aneurysms, cancer, alzheimer and BSE (mad cow disease) etc.

Findings:
Having taken more than 12.000 photographs since 1993, I found that the most simple of these three deamination products, namely the uracil base, has unique chemical and biophysical features when compared to the other two. Some of these are listed below:
1) When autoclaved for 1,5 hours at 140 degrees Celsius, the saturated solution of the uracil base is not denatured. The bacteriological cultures of sterilised uracil are observed to have formed HeLa cell-like colonies after 8 weeks under sterile conditions (performed at the Bacteriology Laboratory of Ankara University Faculty of Veterinary and Ankara Güven Laboratory ).
2) When the uracil base is mixed with water, it undergoes a reaction revealing cellulose and nitrogen (see the reaction below).
3C4H4N2O2 + 6H2O ? 2C6H12O6 + 3N2
One cellulose molecule consists of two moles of glucose linked by ß1-4 glycosidic bonds.
3) The cellulose molecules, which develop from the uracil base behave like lyotropic liquid crystals (for a detailed review of liquid crystals see Kelker and Hatz: 1980). Depending on the quality and the quantity of the water (see the second paragraph in the methodology) and on the amount of and type of substances present in water, they can take various forms, i.e. symetic, amyloid, granular, isotroph, anisotroph, vesicular, reticular and concentric, by changing their positions and directions. However, there are three basic forms: cellulose vesicles, cellulose nodules (not glia or lymphocyte) and cellulose fibrilles.
4) In the experiments performed to observe the appearance of the uracil base in plants, when the juice of pot grown lily stems was mixed with water and/or with CGH, [from proplastids towards chloroplasts] some prechloroplastic developments such as, photosynthetic membranes, prochloron, pregranal, plastids, ameboplastids, cellulose micro fibrilles, cellulose fibrilles and micro granules, were seen.
5) When the complement of the uracil, namely the adenine base, is added to the cultures of uracil and water, uracil’s ability of producing cellulose and nitrogen enhances. This condition leads to a significant increase in nitrogen amount. Furthermore, chains of hypha and ascus-like cellulose vesicles appear in the medium.
6) To test this increase in nitrogen, I added Bradirizobium Japonicum (a nitrogen fixing bacterium) to the aforementioned culture. The subsequent developments of nodule, egzo-nodule and absorptive micelles in the medium, indicate that the bacterium consumes this nitrogen.
7) When the quality of the water used for the cultures of the uracil base is transformed by adding either sugar, CGH or tobacco extract, there occurs some changes resembling the so-called artefact appearances in histopathologic preparations.
8) Various appearances of the uracil base highly resemble the histopathologic preparations of arteriosclerosis, multiple sclerosis, aneurysms, cancer, alzheimer and BSE (see the photographs).

Discussion: The Uracil Base, the Universal Phylogenetic Tree and the structure of DNA
The greatest obstacle for the researchers who try to find the gene which starts the universal Phylogenetic tree is the fact that the water which is yielded whilst nucleotide monomers react to form phosphodiester bonds, ironically prevents the formation of a new phosphodiester bond (Ertem: 1998). To overcome this problem, some researchers try to catalyse the polymerisation of these nucleotide monomers in clay media. On the other hand, some other researchers, perform experiments in space conditions for the same purpose.
Assuming that we found this gene; it has to go through an evolution towards an autotroph organism which, with its chloroplast and mitochondria, will become the first branches of the universal Phylogenetic tree. In other words, this gene will first form a chloroplast genome. Than it will progress through developments which shall form sugar by a reducing reaction of CO2, H2O and sunlight in the grana and thylakoids (specifically developing from this chloroplast genome), and furthermore shall convert this sugar into cellulose.
However, my study shows that at the very beginning of the universal Phylogenetic tree there lay a molecule rather than a gene. In the conditions of the primitive earth, it is known that besides alanine, glycine and isoleucine amino acids synthesized by abiogenesis, uracil and adenine bases were also present (Kohler: 1998). As far as the progression of such a ‘mixture’ in water is concerned, it is highly probable that the uracil base, without the requirement of a genome, will form cellulose in the presence of water. Thus, it allows the formation of lakes and oceans filed with enough cellulose necessary for the development of the heterotropic life in primitive earth conditions, exactly the way today’s plants are producing cellulose in excessive quantities, without giving flowers and seeds, causing unwanted proliferation in the field.
To this end, when uracil (a preprocaryotic molecule formed through abiogenesis) meets with water it is converted into a new molecule, namely cellulose. This cellulose does not dissolve in water. Moreover, it takes the first steps from abiogenesis to biogenesis by forming the hydrophobic environment necessary for the polymerisation of nucleotides.
The findings of this study also reveal some important issues related to the structural features of DNA. Oktay Sinanoglu, for instance, highlights the fact that DNA has solvo-phobic characteristics, therefore it rotates around its own axis (Sinanoglu: 2001). In this context, DNA tries to prevent protection from water, through the conversion of cytosine into uracil thanks to the eagerness for water of the uracil base. This property of the DNA may be called ‘solvo tropic force’.

Conclusion:
The uracil base which started biogenesis in the waters in the primitive earth conditions, when separated (as a result of heat fluctuations or upon chemical, physical cancerous effects that spoil the genes) from the genome in today’s living organisms and mixed with cell water, develops itself as it starts the universal Phylogenetic tree from zero and enlarges the entropy of the system founded by the genome. In caryoplasm, cytoplasm, intercellular tissue, artery, blood or in organs and tissues it takes various forms and shows miscellaneous developments. It is neither nucleic acid, gene, virus, bacteria, protozoon, fungus, protein, nor prion, but a preprocaryotic molecule transformed into cellulose capable of giving those appearances. We can liken this to innumerable forms of insects, flowers, etc. made from glass paste under high temperatures in a workshop, none of them being real insects and flowers, but formations shaped by glass molecules which cannot be spoilt in the face of heat.
Cellulose making process of uracil base started at the level of molecule, micro fibril, misel and/or fibril, causes the changing of the relationship of the cells with all tissues, organs and systems and the ageing of the system, by escaping the control of the organism’s defence mechanism and by negatively affecting the functions of the cells related to the production of enzymes, hormones, secretes and neuro-secretions etc. If the cellulose making process is carried in the arteries, this situation becomes the trigger of the developments which may result in infarctus or hypertension by narrowing or blocking the inner surface of the artery.
In short, uracil base both starts the life by causing the universal Phylogenetic tree to leap from abiogenesis over to biogenesis and becomes a life destroying factor by generating such diseases as cancer, arteriosclerosis, multiple sclerosis and aneurysms, through enlargement of the entropy of the system founded by the genome when it separates from the latter in the metazoa.

References:
Alberts, B. et. Al. (1983) Molecular Biology of the Cell. Garland Publishing Inc. NewYork & London. pp.216-220.
Ertem, G. (1998) Ilk canlinin ortaya çikisi ve ilk yasamin laboratuvarlarda yeniden baslatilmasi üzerine çalismalar. Cumhuriyet Bilim ve Teknik. No: 581, pp. 11-15.
Kelker, H. ve Hatz, R. (1980) Handbook of Liquid Crystals. Verlag Chemie, Weinheim Deerfield Beach, Florida Basel.
Kohler, P. (1998) Nous sommes tous des extra terrestres. Science et Vie, October, 1998. Translated into Turkish by: Selçuk Alsan, Yasam uzayda mi basladi? Bilim ve Teknik. No: 373, pp. 70-71.
Schroedinger, E. (1945) What is life? Cambridge, Eng. Cambridge University Press.
Sinanoglu, O. (2001) Türk Aynstayni “Oktay Sinanoglu Kitabi” Türkiye Is Bankasi Kültür Yayinlari, genel yayin no: 540. Mas Matbaacilik, Istanbul, pp. 214-215.